scReadSim for 10x scATAC-seq with user-designed open chromatin regions
This tutorial’s main steps and corresponding estimated time usage are as follows (tested on a server with the 256x Intel Xeon Phi CPU 7210 at 1.30 GHz):
Step 1: Import packages and data files: < 1 min
Step 2: Generate features: < 1 min
Step 3: Generate real count matrices: < 1 min
Step 4: Simulate synthetic count matrix: ~ 6 mins
Step 5: Output synthetic read: ~ 2 mins
By default, this tutorial uses Python (Python >= 3.8). However, we also include code chunks using bash commands to preprocess necessary files. To avoid users’ confusion, bash commands start with a symbol $. We also indicate when a following code chunk is using bash commands.
Required softwares for scReadSim
scReadSim requires users to pre-install the following softwares:
Depending on users’ choices, the following softwares are optional:
Pre-process BAM file before scReadSim
Note: This tutorial does not need this pre-process step since the processed BAM file is provided by the scReadSim package (see below Step 1: Import packages and data files).
Input BAM file for scReadSim needs pre-processing to add the cell barcode in front of the read name. For example, in 10x sequencing data, cell barcode TGGACCGGTTCACCCA-1 is stored in the field CB:Z:TGGACCGGTTCACCCA-1.
The following code chunk (bash commands) outputs a read record from the original BAM file.
$ samtools view unprocess.bam | head -n 1
A00836:472:HTNW5DMXX:1:1372:16260:18129 83 chr1 4194410 60 50M = 4193976 -484 TGCCTTGCTACAGCAGCTCAGGAAATGTCTTTGTGCCCACAGTCTGTGGT :FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:50 AS:i:50 XS:i:0 CR:Z:TCCGGGACAGCTAACA CY:Z:FFFFFFFFFFFFFFF: CB:Z:TGGACCGGTTCACCCA-1 BC:Z:AAACTCAT QT:Z::FFFFFFF RG:Z:e18_mouse_brain_fresh_5k:MissingLibrary:1:HTNW5DMXX:1
The following code chunk (bash commands) adds the cell barcodes in front of the read names.
$ # extract the header file
$ mkdir tmp
$ samtools view unprocess.bam -H > tmp/unprocess.header.sam
$ # create a bam file with the barcode embedded into the read name
$ time(cat <( cat tmp/unprocess.header.sam ) \
<( samtools view unprocess.bam | awk '{for (i=12; i<=NF; ++i) { if ($i ~ "^CB:Z:"){ td[substr($i,1,2)] = substr($i,6,length($i)-5); } }; printf "%s:%s\n", td["CB"], $0 }' ) \
| samtools view -bS - > processed.bam)
$ rm -dr tmp
$ samtools view processed.bam | head -n 1
TGGACCGGTTCACCCA-1:A00836:472:HTNW5DMXX:1:1372:16260:18129 83 chr1 4194410 60 50M = 4193976 -484 TGCCTTGCTACAGCAGCTCAGGAAATGTCTTTGTGCCCACAGTCTGTGGT :FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:50 AS:i:50 XS:i:0 CR:Z:TCCGGGACAGCTAACA CY:Z:FFFFFFFFFFFFFFF: CB:Z:TGGACCGGTTCACCCA-1 BC:Z:AAACTCAT QT:Z::FFFFFFF RG:Z:e18_mouse_brain_fresh_5k:MissingLibrary:1:HTNW5DMXX:1
Download reference genome for test example
The example deploys scReadSim on the 10x single cell ATAC-seq dataset. For user convienience, we prepared the indexed reference genome files (by bowtie2), which can be downloaded using the following bash commands:
GENCODE reference genome FASTA file and index file(indexed by bowtie2): reference.genome.chr1.tar.gz
GENCODE genome annotation gtf file: gencode.vM10.annotation.gtf
Note: users may need to edit the code by using their own path. The following code chunk is using bash commands.
$ mkdir /home/users/example/refgenome_dir # may use users' own path
$ cd /home/users/example/refgenome_dir
$ wget http://compbio10data.stat.ucla.edu/repository/gayan/Projects/scReadSim/reference.genome.chr1.tar.gz # 292 MB
$ wget http://compbio10data.stat.ucla.edu/repository/gayan/Projects/scReadSim/gencode.vM10.annotation.gtf # 765 MB
$ tar -xf reference.genome.chr1.tar.gz
Step 1: Import packages and data files
Import modules.
import sys, os
import scReadSim.Utility as Utility
import scReadSim.GenerateSyntheticCount as GenerateSyntheticCount
import scReadSim.scATAC_GenerateBAM as scATAC_GenerateBAM
import pkg_resources
The following data files can be accessed by simply loading the code chunk below:
BAM file: 10X_ATAC_chr1_4194444_4399104.bam
cell barcode file: barcodes.tsv
chromosome size file: mm10.chrom.sizes
INPUT_cells_barcode_file = pkg_resources.resource_filename("scReadSim", 'data/barcodes.tsv')
filename = "10X_ATAC_chr1_4194444_4399104"
INPUT_bamfile = pkg_resources.resource_filename("scReadSim", 'data/%s.bam' % filename)
INPUT_genome_size_file = pkg_resources.resource_filename("scReadSim", 'data/mm10.chrom.sizes')
Step 2: Generate features
scReadSim allows users to specify open chromatin regions (referred to as “output peaks”) and then generate synthetic scATAC-seq reads accordingly. When users take this option, scReadSim requires users to input the BAM file, trustworthy peaks and non-peaks (i.e., input peaks and input non-peaks. Alternatively, if users do not specify input peaks and non-peaks, scReadSim by default uses MACS3 with stringent criteria to call trustworthy peaks (q-value 0.01) and non-peaks (q-value 0.1) from the input BAM file) of the BAM file, and a list of output peaks. Given the specified output peaks, scReadSim takes the inter-output-peak as the output non-peaks. In summary, scReadSim defines two sets of peaks and non-peaks: the “input peak and input non-peak” set based on the user-specified (or scReadSim-generated) input peaks and input non-peak and the “output peak and output non-peak” set based on the user-specified output peaks. The following chunks show how to prepare the features for scReadSim with user-spepcified open chromatin regions when anlayzing scATAC-seq data.
Specify output directory
Specify the absolute path of output directory. Create output directory if it does not exist.
outdirectory = "/home/users/example/outputs" # use absolute path
os.mkdir(outdirectory)
Specify pre-installed software paths
Note: users may need to edit the code by using their own path.
samtools_directory="/home/users/Tools/samtools"
macs3_directory="/home/users/Tools/MACS3/bin"
bedtools_directory="/home/users/Tools/bedtools/bedtools2/bin"
seqtk_directory="/home/users/Tools/seqtk"
fgbio_jarfile="/home/users/Tools/fgbio/target/scala-2.13/fgbio-2.0.1-e884860-SNAPSHOT.jar"
Prepare Features
To prepare features for the following analysis, scReadSim utilizes function Utility.scATAC_CreateFeatureSets with following arguments
INPUT_bamfile: Input BAM file for anlaysis.samtools_directory: Directory of software samtools.bedtools_directory: Directory of software bedtools.outdirectory: Output directory of the prepared features.genome_size_file: Directory of Genome sizes file. The file should be a tab delimited text file with two columns: first column for the chromosome name, second column indicates the size.peak_mode: (Optional, default: “macs3”) Specify mode for trustworthy peak and non-peak generation, must be one of the following: “macs3”, “user”, and “superset”.macs3_directory: (Optional, default: None) Path to software MACS3. Must be specified ifINPUT_peakfileandINPUT_nonpeakfileare None.INPUT_peakfile: (Optional, default: None) Directory of user-specified input peak file.INPUT_nonpeakfile: (Optional, default: None) Directory of user-specified input non-peak file.superset_peakfile: (Optional, default: None) Directory of a superset of potential chromatin open regions, including sources such as ENCODE cCRE (Candidate Cis-Regulatory Elements) collection. Must be specified under peak_mode “superset”.OUTPUT_peakfile: (Optional, default: None) Directory of user-specified output peak file. Synthetic scATAC-seq reads will be generated takingOUTPUT_peakfileas ground truth peaks. Note thatOUTPUT_peakfiledoes not name the generated feature files by functionscATAC_CreateFeatureSets.
Three modes are supported by scReadSim to prepare features: “macs3” (default), “user” and “superset”.
Under default mode “macs3” (by setting argument peak_mode as the default values “macs3”), scReadSim uses MACS3 with the stringent criteria to call trustworthy peaks (q-value 0.01) and non-peaks (q-value 0.1) from the input BAM file. This function will generate the following three bed files into directory outdirectory for following analysis:
peak bed file: scReadSim.MACS3.peak.bed
non-peak bed file: scReadSim.MACS3.nonpeak.bed
gray area bed file: scReadSim.grayareas.bed
# Specify the path to OUTPUT_peakfile
OUTPUT_peakfile = pkg_resources.resource_filename("scReadSim", 'data/10X_ATAC_chr1_4194444_4399104.output.peak.bed')
# Mode: macs3
Utility.scATAC_CreateFeatureSets(peak_mode="macs3", INPUT_bamfile=INPUT_bamfile, samtools_directory=samtools_directory, bedtools_directory=bedtools_directory, outdirectory=outdirectory, genome_size_file=INPUT_genome_size_file, macs3_directory=macs3_directory, INPUT_peakfile=None, INPUT_nonpeakfile=None, OUTPUT_peakfile=OUTPUT_peakfile)
Step 3: Generate real count matrices
To consturct count matrix for user-specified output peaks and non-peaks, scReadSim first uses function Utility.FeatureMapping to define the mappings between output peak and input peak, and output non-peak and input non-peak.
Function Utility.FeatureMapping takes following input arguments:
INPUT_bamfile: Input BAM file for anlaysis.input_peaks: BED file of user specified (or generated by scReadSim+MACS3) input peaks.input_nonpeaks: BED file of user specified (or generated by scReadSim+MACS3) input non-peaks.output_peaks: BED file of user specified output peaks.output_nonpeaks: BED file of user specified output non-peaks.outdirectory: Output directory of the features assingment file.assignment_peak_file: Specify the name of peak mapping file.assignment_nonpeak_file: Specify the name of non-peak mapping file.n_top: Specify the number of input peaks (or non-peaks) with the most similar length as the candidate mapped input peaks (or non-peaks) for each the output peak (or non-peak). From the candidate input peaks (or non-peaks), scReadSim further selects the one with largest read density for peak mapping (smallest read density for non-peak mapping).
Two mapping files assignment_file and assignment_nonpeak_file will be output into directory outdirectory.
# Specify the path to bed files generated by Utility.scATAC_CreateFeatureSets
input_peaks = outdirectory + "/" + "scReadSim.MACS3.peak.bed"
input_nonpeaks = outdirectory + "/" + "scReadSim.MACS3.nonpeak.bed"
output_peaks = outdirectory + "/" + "scReadSim.output.peak.bed"
output_nonpeaks = outdirectory + "/" + "scReadSim.output.nonpeak.bed"
# Specify the names of peak mapping files
assignment_peak_file = filename + ".assigned.peaks.txt"
assignment_nonpeak_file = filename + ".assigned.nonpeaks.txt"
# Generate mappings for peaks and nonpeaks
Utility.FeatureMapping(INPUT_bamfile=INPUT_bamfile, input_peaks=input_peaks, input_nonpeaks=input_nonpeaks, output_peaks=output_peaks, output_nonpeaks=output_nonpeaks, outdirectory=outdirectory, assignment_peak_file=assignment_peak_file, assignment_nonpeak_file=assignment_nonpeak_file, n_top=50)
Based on the bed files output in Step 2 and the mapping files output by Utility.FeatureMapping, scReasSim constructs the count matrices for output peaks and non-peaks through function Utility.scATAC_bam2countmat_OutputPeak. This function needs user to specify
cells_barcode_file: Cell barcode file corresponding to the input BAM file.assignment_file: Features assignment file output by functionUtility.FeatureMapping.INPUT_bamfile: Input BAM file for anlaysis.outdirectory: Specify the output directory of the count matrix file.count_mat_filename: Specify the base name of output count matrix.
For the user specified count_mat_filename, scReadSim will generate a count matrix named count_mat_filename.txt to directory outdirectory.
# Specify the output count matrices' base names
count_mat_peak_filename = "%s.output.peak.countmatrix" % filename
count_mat_nonpeak_filename = "%s.output.nonpeak.countmatrix" % filename
# Construct count matrix for peaks
Utility.scATAC_bam2countmat_OutputPeak(cells_barcode_file=INPUT_cells_barcode_file, assignment_file=outdirectory + "/" + assignment_peak_file, INPUT_bamfile=INPUT_bamfile, outdirectory=outdirectory, count_mat_filename=count_mat_peak_filename)
# Construct count matrix for non-peaks
Utility.scATAC_bam2countmat_OutputPeak(cells_barcode_file=INPUT_cells_barcode_file, assignment_file=outdirectory + "/" + assignment_nonpeak_file, INPUT_bamfile=INPUT_bamfile, outdirectory=outdirectory, count_mat_filename=count_mat_nonpeak_filename)
Step 4: Simulate synthetic count matrix
In this tutorial, scReadSim implements scDesign2 to generate synthetic count matrix based on the constructed count matrix from the input BAM file. Use function GenerateSyntheticCount.scATAC_GenerateSyntheticCount to generate synthetic count matrix with following paramters
count_mat_filename: Base name of the count matrix output by functionUtility.scATAC_bam2countmat_paral.directory: Path to the count matrix.outdirectory: Specify the output directory of the synthetic count matrix file.doub_classification_label_file: (Optional, default: ‘None’) Specify the absolute path to the doublet classification resultdoublet_classification.Rdatagenerated by functionDoubletDetection.detectDoublet.n_cell_new: (Optional, default: ‘None’) Number of synthetic cells. If not specified, scReadSim uses the number of real cells.total_count_new: (Optional, default: ‘None’) Number of (expected) sequencing depth. If not specified, scReadSim uses the real sequencing depth.celllabel_file: (Optional, default: ‘None’) Specify the one-column text file containing the predefined cell labels. Make sure that the order of cell labels correspond to the cell barcode file. If no cell labels are specified, scReadSim performs a Louvain clustering before implementing scDesign2.n_cores: (Optional, default: ‘1’) Specify the number of cores for parallel computing when generating count matrix.
Given the input count matrix count_mat_filename.txt, scReadSim generates the syntheitic count matrix file to outdirectory for following analysis:
Synthetic count matrix:
count_mat_filename.scDesign2Simulated.txtSynthetic cell cluster/type labels:
count_mat_filename.scDesign2Simulated.CellTypeLabel.txt
Additionaly, if no celllabel_file is specified, scReadSim automatically performs Louvain clustering from Seurat and outputs clustering labels to outdirectory:
Real cells’ Louvain clustering labels:
count_mat_filename.LouvainClusterResults.txt
# Generate synthetic count matrix for peak-by-cell count matrix
GenerateSyntheticCount.scATAC_GenerateSyntheticCount(count_mat_filename=count_mat_peak_filename, directory=outdirectory, outdirectory=outdirectory)
# Specify cluster labels obtained from peak-by-cell matrix
celllabel_file = outdirectory + "/" + "10X_ATAC_chr1_4194444_4399104.output.peak.countmatrix.LouvainClusterResults.txt"
# Generate synthetic count matrix for nonpeak-by-cell count matrix
GenerateSyntheticCount.scATAC_GenerateSyntheticCount(count_mat_filename=count_mat_nonpeak_filename, directory=outdirectory, outdirectory=outdirectory, celllabel_file=celllabel_file)
Step 5: Output synthetic read
Generate synthetic reads in BED format
Based on the synthetic count matrix, scReadSim generates synthetic reads by randomly sampling from the real BAM file input by users. First use function scATAC_GenerateBAM.scATAC_GenerateBAMCoord_OutputPeak to create the synthetic reads and output in BED file storing the coordinates information. Function scATAC_GenerateBAM.scATAC_GenerateBAMCoord_OutputPeak takes following input arguments:
target_peak_assignment_file: Mapping file between input peaks and output peaks, output by ‘FeatureMapping’.count_mat_file: The path to the synthetic count matrix generated byGenerateSyntheticCount.scATAC_GenerateSyntheticCount.synthetic_cell_label_file: Synthetic cell label file generated byscATAC_GenerateSyntheticCount.read_bedfile_prename: Specify the base name of output bed file.INPUT_bamfile: Input BAM file for anlaysis.outdirectory: Specify the output directory for synthetic reads bed file.OUTPUT_cells_barcode_file: Specify the file name storing the synthetic cell barcodes.jitter_size: (Optional, default: ‘5’) Specify the range of random shift to avoid replicate synthetic reads. Default value is 5 bp.read_len: (Optional, default: ‘50’) Specify the length of synthetic reads. Default value is 50 bp.random_noise_mode: (Optional, default: ‘False’) Specify whether to use a uniform distribution of reads.
This function will output two bed files read_bedfile_prename.read1.bed and read_bedfile_prename.read2.bed storing the coordinates information of synthetic reads and its cell barcode file OUTPUT_cells_barcode_file in directory outdirectory.
After generation of synthetic reads for both peaks and non-peaks, combine the their bed files using function scATAC_GenerateBAM.scATAC_CombineBED, which takes following input arguments:
outdirectory: Directory ofpeak_read_bedfile_prename.txt andnonpeak_read_bedfile_prename.txt.peak_read_bedfile_prename: Base name of the bed file containig synthetic reads for peaks (generated by functionscATAC_GenerateBAM.scATAC_GenerateBAMCoord).nonpeak_read_bedfile_prename: Base name of the bed file containig synthetic reads for non-peaks (generated by functionscATAC_GenerateBAM.scATAC_GenerateBAMCoord).BED_filename_combined_pre: Specify the base name for the combined syntehtic reads bed file. The combined bed file will be output tooutdirectory.
# Specify the names of synthetic count matrices (generated by GenerateSyntheticCount.scATAC_GenerateSyntheticCount)
synthetic_countmat_peak_file = count_mat_peak_filename + ".scDesign2Simulated.txt"
synthetic_countmat_nonpeak_file = count_mat_nonpeak_filename + ".scDesign2Simulated.txt"
# Specify the base name of bed files containing synthetic reads
OUTPUT_cells_barcode_file = "synthetic_cell_barcode.txt"
peak_read_bedfile_prename = "%s.syntheticBAM.peak" % filename
nonpeak_read_bedfile_prename = "%s.syntheticBAM.nonpeak" % filename
BED_filename_combined_pre = "%s.syntheticBAM.combined" % filename
synthetic_cell_label_file = count_mat_peak_filename + ".scDesign2Simulated.CellTypeLabel.txt"
# Create synthetic read bed file for peaks
scATAC_GenerateBAM.scATAC_GenerateBAMCoord_OutputPeak(target_peak_assignment_file=outdirectory + "/"+ assignment_peak_file, count_mat_file=outdirectory + "/" + synthetic_countmat_peak_file, synthetic_cell_label_file=outdirectory + "/" + synthetic_cell_label_file, read_bedfile_prename=peak_read_bedfile_prename, INPUT_bamfile=INPUT_bamfile, outdirectory=outdirectory, OUTPUT_cells_barcode_file=OUTPUT_cells_barcode_file, jitter_size=5, read_len=50)
# Create synthetic read bed file for non-peaks
scATAC_GenerateBAM.scATAC_GenerateBAMCoord_OutputPeak(target_peak_assignment_file=outdirectory + "/"+ assignment_nonpeak_file, count_mat_file=outdirectory + "/" + synthetic_countmat_nonpeak_file, synthetic_cell_label_file=outdirectory + "/" + synthetic_cell_label_file, read_bedfile_prename=nonpeak_read_bedfile_prename, INPUT_bamfile=INPUT_bamfile, outdirectory=outdirectory, OUTPUT_cells_barcode_file=OUTPUT_cells_barcode_file, jitter_size=5, read_len=50)
# Combine bed files
scATAC_GenerateBAM.scATAC_CombineBED(outdirectory=outdirectory, peak_read_bedfile_prename=peak_read_bedfile_prename, nonpeak_read_bedfile_prename=nonpeak_read_bedfile_prename, BED_filename_combined_pre=BED_filename_combined_pre, GrayAreaModeling=False)
Convert BED files to FASTQ files
Use function scATAC_BED2FASTQ to convert BED file to FASTQ file. This function takes the following arguments:
bedtools_directory: Path to software bedtools.seqtk_directory: Path to software seqtk.referenceGenome_file: Reference genome FASTA file that the synthteic reads should align.outdirectory: Output directory of the synthteic bed file and its corresponding cell barcodes file.BED_filename_combined: Base name of the combined bed file output by functionscATAC_CombineBED.synthetic_fastq_prename: Specify the base name of the output FASTQ files.
This function will output paired-end reads in FASTQ files named as synthetic_fastq_prename.read1.bed2fa.sorted.fq, synthetic_fastq_prename.read2.bed2fa.sorted.fq to directory outdirectory.
Note: users may need to edit the code by using their own path.
referenceGenome_name = "chr1"
referenceGenome_dir = "/home/users/example/refgenome_dir" # may use users' own path
referenceGenome_file = "%s/%s.fa" % (referenceGenome_dir, referenceGenome_name)
synthetic_fastq_prename = BED_filename_combined_pre
# Convert combined bed file into FASTQ files
scATAC_GenerateBAM.scATAC_BED2FASTQ(bedtools_directory=bedtools_directory, seqtk_directory=seqtk_directory, referenceGenome_file=referenceGenome_file, outdirectory=outdirectory, BED_filename_combined=BED_filename_combined_pre, synthetic_fastq_prename=synthetic_fastq_prename)
Introduce Error to synthetic data
Use function scATAC_ErrorBase to introduce random error to synthetic reads.
Build reference genome dictionary (optional)
Note that before using function scATAC_ErrorBase, please create the reference dictionary for the reference genome with function CreateSequenceDictionary using software Picard and make sure that the output .dict files are within the same directory to referenceGenome_name.fa.
Note: For this tutorial, no dictionary building is needed since we have built for chr1.fa in reference.genome.chr1.tar.gz. The following code chunk is using bash commands.
$ cd /home/users/example/refgenome_dir # may use users' own path
$ java -jar /home/users/picard/build/libs/picard.jar CreateSequenceDictionary \
$ -R chr1.fa \
$ -O chr1.fa.dict
Introduce errors to synthetic reads
Function scATAC_ErrorBase takes the following arguments:
fgbio_jarfile: Path to software fgbio jar script.INPUT_bamfile: Input BAM file for anlaysis.referenceGenome_file: Reference genome FASTA file that the synthteic reads should align.outdirectory: Specify the output directory of the synthteic FASTQ file with random errors.synthetic_fastq_prename: Base name of the synthetic FASTQ files output by functionscATAC_BED2FASTQ.
This function will output synthetic reads with random errors in FASTQ files named as synthetic_fastq_prename.ErrorIncluded.read1.bed2fa.fq, synthetic_fastq_prename.ErrorIncluded.read2.bed2fa.fq to directory outdirectory.
# Generate reads with errors in FASTQs
scATAC_GenerateBAM.scATAC_ErrorBase(fgbio_jarfile=fgbio_jarfile, INPUT_bamfile=INPUT_bamfile, referenceGenome_file=referenceGenome_file, outdirectory=outdirectory, synthetic_fastq_prename=synthetic_fastq_prename)
Convert FASTQ files to BAM file (optional)
The current version of scReadSim implicitly uses bowtie2 to align the synthetic reads onto the reference genome. Use function AlignSyntheticBam_Pair to align FASTQ files onto reference genome. It takes the following arguments:
bowtie2_directory: Path to software bowtie2.samtools_directory: Path to software samtools.outdirectory: Specify the output directory of the synthteic BAM file.referenceGenome_name: Base name of the reference genome FASTA file. For example, you should input “chr1” for file “chr1.fa”.referenceGenome_dir: Path to the reference genome FASTA file.synthetic_fastq_prename: Base name of the synthetic FASTQ files output by functionscATAC_BED2FASTQ.output_BAM_pre: Specify the base name of the output BAM file.
Index reference genome (optional)
Before using function AlignSyntheticBam_Pair, the reference gemome FASTA file should be indexed by bowtie2 through following chunk and make sure the output index files are within the same directory to referenceGenome_name.fa.
Note: For this tutorial, no indexing is needed since we have indexed chr1.fa in reference.genome.chr1.tar.gz. The following code chunk is using bash commands.
$ cd /home/users/example/refgenome_dir # may use users' own path
$ bowtie2-build chr1.fa chr1
Align synthetic reads
Now align the synthetic reads on to the reference genome with bowtie2.
# Specify bowtie2 path
bowtie2_directory="/home/users/Tools/bowtie2/bin"
# Specify output BAM name
output_BAM_pre = "%s.syntheticBAM.CBincluded" % filename
# Synthetic reads alignment
scATAC_GenerateBAM.AlignSyntheticBam_Pair(bowtie2_directory=bowtie2_directory, samtools_directory=samtools_directory, outdirectory=outdirectory, referenceGenome_name=referenceGenome_name, referenceGenome_dir=referenceGenome_dir, synthetic_fastq_prename=synthetic_fastq_prename, output_BAM_pre=output_BAM_pre)
# Synthetic reads (with sequencing errors) alignment
scATAC_GenerateBAM.AlignSyntheticBam_Pair(bowtie2_directory=bowtie2_directory, samtools_directory=samtools_directory, outdirectory=outdirectory, referenceGenome_name=referenceGenome_name, referenceGenome_dir=referenceGenome_dir, synthetic_fastq_prename=synthetic_fastq_prename + ".ErrorIncluded" , output_BAM_pre=output_BAM_pre+ ".ErrorIncluded")